The aim of this study was to investigate piscine mycobacteriosis in wild sharptooth catfish, Clarias gariepinus. Out of 120 fish collected, Mycobacterium SPP. Were isolated from fish 5 (4.16%), M. fortuitum was isolated from 3 (2.5%), while M. marinum was isolated from 2 (1.67%) fish. Conventional and molecular methods were applied to identify suspected mycoacterial isolates. Experimental induction of mycobacteriosis in sharptooth catfish by intraperitoneal inoculation of 1.2X108 and 1.6X108 cfu of M. fortuitum (MF4) and M. marinum (MM31), respectively, resulted in acute infections with severe peritonitis and adhesions. Less severe to chronic cases resulted from intraperitoneal inoculation of 1.2X107 and 1.6X107 cfu of M. fortuitum and M. marinum, respectively. Sharptooth catfish with induced chronic M. fortuitum infections showed severe enlargement of the spleen and dark coloration of the liver and kidneys, while induced chronic M. marinum showed sanguineous granular ascites. Antibiograms of the isolates were also conducted. The fisherman dealing with sharptooth catfish had developed nodules on the dorsum of hand that could be a case of fish handler granuloma

The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 7 Erysipelothrix reference strains and 13 random primers were tested. Among the tested primers, the primers NK6 (CCCGCGCCCC) and D9355 (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK6 revealed 5 RAPD patterns (a∼e) while primer D9355 revealed 8 RAPD patterns (A∼H) that were not serovar specific. Namely, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar 1a E. rhusiopathiae strains including strain Koganei 65-0.15 for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D9355 is a rapid and reliable method to differentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species.

Acriflavine-resistant Erysipelothrix rhusiopathiae isolates, defined as serovar la, from arthritic pigs at slaughter houses in Ishikawa prefecture between 1994 and 1995 were compared pathologically and genetically with acriflavine-fast attenuated strain of E. rhusiopathiae used for live vaccine. Twelve of 18 field isolates were resistant to 0.01 % acriflavine similarly to the vaccine strain. Four of the above 12 isolates showed the pathogenicity for mice similar to the vaccine strain. Only one of 7 isolates representative to the above 12 strains showed the pathogenicity for swine similar to the vaccine strain and an identical pattern with the vaccine strain in pulsed-field gel electrophoresis (PFGE). However, the remaining 6 isolates were more pathogenic for pigs than the vaccine strain and showed 4 patterns different from the vaccine strain in PFGE. The present results indicated the incidence of acriflavine-resistant avirulent E. rhusiopathiae strains in the field and pathological and genetical variety of those strains. An appropriate marker other than acriflavine resistance for the vaccine strain must be established. (author abst.)

A survey for hydatidosis among the slaughtered animals at Assiut and Aswan abattoirs, over one year showed that hydatid cyst camels was 107 (7.67%) out of 1395, but no infection in cattle and buffaloes. The lung was more involved than liver in camels. The fertile hydatid cysts in camels were 60.41% and 54.23% in Assiut and Aswan Governorates respectively. The hydatid cysts recorded in Assiut and Aswan Gs during Summer (15.78%, 6.34%) or Autumn (12.0%, 7.83%) was higher than during Winter (10.58%, 3.03%) or Spring (10.52%, 5.18%). Fresh fertile hydatid cysts protoscolices were recovered from lungs of infected camels, slaughtered at Bani-Adi (Assiut) abattoir were orally given to experimental dogs. All dogs developed Echinococcus worms mainly in the small intestine proximal third. The levels of echinococcosis by IHAT were estimated in 100 patients with acute & chronic hepatic diseases in Assiut and in Aswan Gs, showed 5 (10.0%) positive reactions.

For 79 isolates from the tonsils of healthy cattle identified as Erysipelothrix by cultivation, biochemical and serological tests, genotypic identification was performed by polymerase chain reaction (PCR) using four species-specific sets of oligonucleotide primers (ER1F-ER1R, ER2F-ER2R, ER3F-ER3R and ER4F-ER4R). The results of PCR for 79 bovine isolates were compared with those of serological typing. For 19 isolates, serotyping and genotyping results were the same. PCR allowed for the identification of 36 untypable isolates as Erysipelothrix species, strain 1. Serotyping and genotyping results of the remaining 24 isolates were different. Supplemental tests are frequently needed for Erysipelothrix identification.

The pathogenicity of 79 Erysipelothrix isolates from bovine tonsils for mice and swine was determined. Five (6.3%) isolates were lethal for mice. These isolates belonged to serovars 1b (one isolate), 2 (2), 19 (1) and 21 (1). The 50% lethal dose values of the isolates ranged from 0.33 to 5x10(2) CFUs in mice. Twenty Erysipelothrix isolates (25.3%) were weakly virulent inducing only emaciation while 12 (15.2%) inducing emaciation and ruffled hair. In swine, clinical signs of varying severity were observed. Four isolates were virulent, capable of inducing localized or generalized urticarial lesions accompanied with a rise in body temperature after intradermal inoculation. One isolate each of serovars 1b, 2 and 19 was highly virulent, capable of inducing generalized urticarial lesions while another Erysipelothrix isolate of serovar 2 induced only a localized urticarial lesion at the site of inoculation. Another isolate of serovar 1b induced itching and irritation without obvious urticarial lesion at the site of inoculation. On the other hand, one isolate of serovar 21 and two other isolates of serovar 2 could not induce experimentally any clinical sign of erysipelas other than rise in body temperature. There was a rise in growth agglutination (GA) titer of serum in all the inoculated swine. These observations suggest that Erysipelothrix isolates from cattle are pathogenic for mouse and swine, and may also be pathogenic for other animals and humans

Serum samples collected from 854 cattle in nine prefectures of Japan, from Hokkaido to Okinawa, between 1988 and 1992 were examined for presence of antibodies against Erysipelothrix rhusiopathiae by growth agglutination test. Most of the sera showed positive reactions, and the antibody titers ranged from below 4 to above 128. Seventy-six percent of the sera showed titers of 32 or above, and 34% showed titers of 128 or above. The titers had a tendency to be higher in the south and lower in the north and were clearly low in sera from areas with no swine industry. These results indicated that Japanese cattle had been infected with E. rhusiopathiae and that clinical cases of the disease were possible.

Serovars of 79 Erysipelothrix isolates recovered from the tonsils of healthy slaughtered cattle over a 1-year period in Japan were determined by an agar double-diffusion precipitation system using typing sera representing all the known serovars, 1 through 23 and type N, of Erysipelothrix. A total of 43 out of the 79 Erysipelothrix isolates could be classified into nine serovars but the remaining 36 isolates were untypable. Of 42 isolates identified as Erysipelothrix rhusiopathiae, 4, 6, 2, 3, 1,12, 13 and 1 isolates belonged to serovars 1b, 2, 5, 9, 12, 13, 19 and 21, respectively. One isolate belonged to Erysipelothrix tonsillarum serovar 3.

Erysipelothrix species were isolated from the tonsils of 79(6.4%) of 1,236 healthy cattle slaughtered in 4 prefectures, Yamagata, Miyagi, Nagasaki, and Tokyo, in Japan from September, 1998, to August, 1999. A combination, modified culture medium consisted of brain heart infusion(BHI) broth containing 0.1% Tween 80, 5% horse serum, 50.MU.g/ml gentamicin, 0.1% sodium azide and 0.001% crystal violet, and BHI agar containing 0.1% Tween 80, 50.MU.g/ml gentamicin, and 0.1% sodium azide was compared with two traditional media for isolation of Erysipelothrix species. The modified media were the most effective since they produced the highest number of Erysipelothrix isolates(p0.01) as well as the greatest degree of inhibition of the growth of contaminated organisms. The isolation rates in summer(10.3%) and spring(7.1%) was higher than those in autumn(2.6%) or winter(1.3%)(p0.01). (author abst.)